Plasmid transfer

You are trying to construct a plasmid to be transfected (introduced) into mouse tissue culture cells in order to find out whether a specific protein localizes to the nucleus or the cytoplasm. You have three purified plasmids as starting materials. The objective is to combine pieces of these plasmids to make one purified plasmid suitable for the proposed experiment.
One plasmid contains a promoter/enhancer that is active in the mouse tissue culture cells and downstream of that promoter (in the same plasmid) are suitable sequences for initiating translation of an RNA transcript to produce several amino acids of a protein. These amino acids include the sequence MDYKDDDDK (single-letter code) at the very beginning (M is the initiator methionine). That stretch of amino acids is called an epitope tag (it is actually the FLAG tag) because it can be recognized by an antibody when it forms part of a protein. Following the sequence encoding the FLAG tag are a number of restriction enzyme sites (BamHI, XbaI and EcoRI). Do not worry about the restriction sites being so close to each other. In reality that can make it difficult to cut with two of these enzymes together but assume here that there is no problem for an enzyme to cut at a site very close to the end of a DNA molecule.
The second plasmid contains a full-length cDNA for the gene of interest (let's call it GLI-1). Conveniently, there is an NcoI site (CCATGG) right at the initiator codon (the ATG sequence within the NcoI site).
The third plasmid includes a region of a different gene that acts, when transcribed, as a signal for the transcript to be cleaved and polyadenylated (which is important for mRNA stability and translation). The signal works if RNA is transcribed in the direction from XbaI to EcoRI.
The desired product includes the promoter and FLAG epitope coding sequence from the first plasmid connected to the GLI-1 cDNA (such that the whole GLI-1 protein is translated following the FLAG epitope to make a "tagged" fusion protein) and to the XbaI-EcoRI polyadenylation signal segment. It is not important if there are a few extra amino acids between the FLAG tag and the rest of the normal GLI-1 protein and the success of the experiment does not depend on the nature or length of the 3' UTR (untranslated region) of the mRNA made in the mouse cells. You can assume that the restriction sites shown do not occur at any additional locations in the plasmids shown and that all of the plasmids have ampicillin-resistance genes. You can use any additional materials (oligos, enzymes etc.) you think appropriate. BamHI cuts between the Gs and NcoI between the Cs in their recognition sequence, on each strand.

(i) Describe how you would make the desired plasmid (WITHOUT using PCR)
In your answer be sure to make clear
(a) the exact sequences of any additional DNAs you use AND the exact sequence in your final construct between the FLAG epitope and the start of the GLI-1 cDNA.
(b) steps in the procedure including purifications (explaining why they are necessary or optional)
(c) how you will identify a correct product and
(d) how you will make sure that the correct product is indeed definitely correct (pointing out the most likely imperfection you may come across).

(ii) You have exactly the same objective as in (i) except that now
(a) you are allowed to use PCR
(b) the first plasmid has the same promoter/enhancer but does not have FLAG epitope sequence; instead there is just a BamHI site followed by an XbaI site and an EcoRI site at that position (just GGATCCATCTAGATCGAATTC from the sequence shown in part (i)) and
(c) the second and third plasmids no longer have any of the indicated restriction sites (say because the NcoI site is now TCATGG, the XbaI sites are TCGAGA and the EcoRI site GAGTTC, though the precise reason is not important).

How do you make the desired plasmid that will encode GLI-1 with an N-terminal FLAG epitope?
Pay attention to the same four issues as described in (i), including specifying the length of any primers used and the location of their binding sites (sites of hybridization) where actual sequences are not known (include sequence in places where it is known).